Pended in 50 ml of ultra-pure water, and the DNA was stored

Pended in 50 ml of ultra-pure water, and the DNA was stored at 220uC. PCR was performed according to Britto et al. (1995), with 7.5 ml of the extracted DNA in a final volume of 100 ml containing 10 ml of reaction buffer (Buffer II, consisting of 100 mM Tris HCl, pH 8.3 and 500 mM KCl), MgCl2 (25 mM MgCl2), 100 ng/ml of primers 121 [Assessment of IgM and Anti- T. cruzi IgG AntibodiesFor quantitative and qualitative assessments of antibodies, we used indirect IFA and IHA. T. cruzi epimastigotes were freezedried for immunofluorescence and fixed on slides. AfterClinical Follow-Up of Acute Chagas DiseaseFigure 1. Distribution of acute Chagas disease cases per year of diagnosis. doi:10.1371/journal.pone.0064450.gAAATAATGTACGG(T/G)-GAGATGCATGA-39and 122 [59 CGTTCGATTGGGGTTGGTGTAATATA-39, which amplified a 330 pb fragment of the conserved micro region of T. cruzi kDNA minicircles, 2 ml of dNTPs (10 mM) and 0.75 ml of AmpliTaq Gold (Applied Biosystems) and with modifications performed by the Laboratory of Parasitic Diseases, Department of Tropical Medicine (DMT), FIOCRUZ. The samples were processed and amplified in duplicate. The PCR condition was performed to ensure that all fragment were completely synthesized (95uC for 129 – 1 cycle/98uC for 19 – 2 cycles, 64uC for 19-2 cycles/ 94uC for 19/64uC for 19 – 33 cycles/72uC for 109 – 1 cycle/4uC for 609 [13]. As positive and negative controls, DNA was isolated from the blood of confirmed chagasic and non-chagasic patients, respectively. In cases where the PCR result was negative, a second amplification was performed using primers PC03 (forward) (ACACAACTGTGTTCACTAGC) and PC04 (reverse) d(CAACTTCATCCACGTTCACC), which are specific for the human b-globin gene, to determine whether the negative result was due to PCR inhibitors in the samples.comparison, with a significance level of less than 0.05. The results of the parasitological tests were analyzed from the beginning of treatment and during follow-up in the form of descriptive statistics (frequencies). For analysis of clinical conditions, were considered two points in time: assessments relating to the initiation of treatment (acute phase) and 2005 (end point). We considered the following parameters for this classification: results of serology, electrocardiographic abnormalities compatible with Chagas disease at any phase and/or echocardiographic changes suggestive of chronic Chagas disease. For the analysis of cardiac tests, two blind readers assessed the traces from both tests performed during the acute phase (retrospective) and those made during the follow-up period. Therefore, to provide a cross-sectional classification of the recent clinical condition, a paired comparison was made on a case-bycase basis between results from ECG and echocardiography and from serological and parasitological purchase 47931-85-1 assays. Co-morbidities of heart disease were also examined individually. Here, we provide a summary of the cardiac analysis that was fully described in an earlier publication [15].Treatment ProceduresAll order SMER-28 patients were treated with benznidazole (RochaganH) (BZ) at a dose of 5 to 7 mg per kg per day for 60 or 90 days, following established medical criteria The treatment was beguine as soon as diagnose was made and this is assured by coordinator of the Cinical Protocol, one of the authors [14].ResultsWe studied 179 patients between 2 and 72 years of age that had been diagnosed with acute Chagas disease between 1988 and 2005. Patients were included in the study bas.Pended in 50 ml of ultra-pure water, and the DNA was stored at 220uC. PCR was performed according to Britto et al. (1995), with 7.5 ml of the extracted DNA in a final volume of 100 ml containing 10 ml of reaction buffer (Buffer II, consisting of 100 mM Tris HCl, pH 8.3 and 500 mM KCl), MgCl2 (25 mM MgCl2), 100 ng/ml of primers 121 [Assessment of IgM and Anti- T. cruzi IgG AntibodiesFor quantitative and qualitative assessments of antibodies, we used indirect IFA and IHA. T. cruzi epimastigotes were freezedried for immunofluorescence and fixed on slides. AfterClinical Follow-Up of Acute Chagas DiseaseFigure 1. Distribution of acute Chagas disease cases per year of diagnosis. doi:10.1371/journal.pone.0064450.gAAATAATGTACGG(T/G)-GAGATGCATGA-39and 122 [59 CGTTCGATTGGGGTTGGTGTAATATA-39, which amplified a 330 pb fragment of the conserved micro region of T. cruzi kDNA minicircles, 2 ml of dNTPs (10 mM) and 0.75 ml of AmpliTaq Gold (Applied Biosystems) and with modifications performed by the Laboratory of Parasitic Diseases, Department of Tropical Medicine (DMT), FIOCRUZ. The samples were processed and amplified in duplicate. The PCR condition was performed to ensure that all fragment were completely synthesized (95uC for 129 – 1 cycle/98uC for 19 – 2 cycles, 64uC for 19-2 cycles/ 94uC for 19/64uC for 19 – 33 cycles/72uC for 109 – 1 cycle/4uC for 609 [13]. As positive and negative controls, DNA was isolated from the blood of confirmed chagasic and non-chagasic patients, respectively. In cases where the PCR result was negative, a second amplification was performed using primers PC03 (forward) (ACACAACTGTGTTCACTAGC) and PC04 (reverse) d(CAACTTCATCCACGTTCACC), which are specific for the human b-globin gene, to determine whether the negative result was due to PCR inhibitors in the samples.comparison, with a significance level of less than 0.05. The results of the parasitological tests were analyzed from the beginning of treatment and during follow-up in the form of descriptive statistics (frequencies). For analysis of clinical conditions, were considered two points in time: assessments relating to the initiation of treatment (acute phase) and 2005 (end point). We considered the following parameters for this classification: results of serology, electrocardiographic abnormalities compatible with Chagas disease at any phase and/or echocardiographic changes suggestive of chronic Chagas disease. For the analysis of cardiac tests, two blind readers assessed the traces from both tests performed during the acute phase (retrospective) and those made during the follow-up period. Therefore, to provide a cross-sectional classification of the recent clinical condition, a paired comparison was made on a case-bycase basis between results from ECG and echocardiography and from serological and parasitological assays. Co-morbidities of heart disease were also examined individually. Here, we provide a summary of the cardiac analysis that was fully described in an earlier publication [15].Treatment ProceduresAll patients were treated with benznidazole (RochaganH) (BZ) at a dose of 5 to 7 mg per kg per day for 60 or 90 days, following established medical criteria The treatment was beguine as soon as diagnose was made and this is assured by coordinator of the Cinical Protocol, one of the authors [14].ResultsWe studied 179 patients between 2 and 72 years of age that had been diagnosed with acute Chagas disease between 1988 and 2005. Patients were included in the study bas.