L saline vehicle, and group 3 received TNF + losartan (LOS, 1 mg/kg

L saline vehicle, and group 3 received TNF + losartan (LOS, 1 mg/kg, ip), for 5 days. Rats were sacrificed by carbon dioxide inhalation, and left ventricle (LV) samples were collected for gene expression and LED-209 cost measurement of oxidative stress markers. Mitochondria were isolated by differential centrifugation for functional studies. Electron paramagnetic resonance (EPR) spectroscopy was used to measure free radical production in the cytosolic and mitochondrial fractions. The structural integrity of mitochondrial 1676428 membranes was measured using swelling assay and transmission electron microscopy (TEM) analysis.Table 1. Rat primers used for RT-PCR.Gene GAPDH gp91phox NOX4 AT-1R TNF-a eNOS iNOS CPT1 CPT2 PGC1a PGC1b UCPTNF agacagccgcatcttcttgt cggaatcctctccttcct ttctacatgctgctgctgct caacctccagcaatcctttc gtcgtagcaaaccaccaagc ggcatacagaacccaggatg ccttgttcagctacgccttc ctcagcctctacggcaaatc ctaatcccaaggtgcttcca aagcaggtctctccttgcag tggatgagctttcactgctg ggcccaacatcacaagaaacAntisense cttgccgtgggtagagtcat gcattcacacaccactccac aaaaccctccaggcaaagat cccaaatccatacagccact tgtgggtgaggagcacatag ggatgcaaggcaagttagga ggtatgcccgagttctttca tgcccatgagtgttctgtgt cttcagttgggctctt ccatcccgtagttcactggt tggatgagctttcactgctg agctccaaaggcagagacaaBlood PressureBlood pressure were measured noninvasively using a Coda 6 Blood Pressure Calcitonin (salmon) biological activity System (Kent Scientific, Torrington, CT), which utilizes a tail-cuff 25837696 occlusion method and volume pressure recording (VPR) sensor technology. In this system, unanesthtized rats from each group were warmed to an ambient temperature of 30uC by placing them in a holding device mounted on a thermostatically controlled warming plate. Rats were allowed to habituate to thisdoi:10.1371/journal.pone.0046568.tTNF, ANG II, and Mitochondrial DysfunctionIsolation of Mitochondria and Mitochondrial Functional StudiesLV mitochondria were isolated by differential centrifugation of heart homogenates as described previously [11]; for assessment of permeability transition pore opening, mitochondrial swelling was measured as described previously [11,22]. Ultrastructural examination of isolated mitochondrial preparations was performed as described before [22].Table 2. Blood pressure data from control and experimental groups.DaysMAP mmHg Control TNF 11060.55 11560.11 11060.22 11060.02 11560.22 TNF +LOS 10560.23 11060.05 10560.05 11060.11 11460.111161.57 10860.69 10960.33 11260.88 11460.Western BlottingProtein expression in mitochondria was analyzed by western blotting as previously described [11,22], using anti-ANT, anticytochrome c and anti-VDAC antibodies (Santa Cruz Biotechnology). The band intensities were quantified using a BioRad ChemiDoc imaging system and normalized to VDAC.3 4Mitochondrial O2N2 and H2O2 production in mitochondria were measured using EPR as described previously [12,22]. [23]Aliquots of isolated LV mitochondria were probed with PPH (500 mM) alone or PPH and SOD (50 U/ml) for quantification of O2N2 production. Catalase (50 U/ml) was added to measure H2O2 formation. PPH allows the detection of extracellular and extra mitochondrial production of O2N2 [24]. PPH reacts with O2N2 to produce a stable PPN nitroxide radical which can be detected with EPR [25]. After adequate mixing, 50 ml of mitochondria were taken in 50 ml glass capillary tubes. Mitochondrial O2N2 production and H2O2 production were determined by EPR under the same settings as were used for measurement of mitochondrial O2N2 and H2O2 production.Mitochondrial O2N2 and H2O2 ProductionMean a.L saline vehicle, and group 3 received TNF + losartan (LOS, 1 mg/kg, ip), for 5 days. Rats were sacrificed by carbon dioxide inhalation, and left ventricle (LV) samples were collected for gene expression and measurement of oxidative stress markers. Mitochondria were isolated by differential centrifugation for functional studies. Electron paramagnetic resonance (EPR) spectroscopy was used to measure free radical production in the cytosolic and mitochondrial fractions. The structural integrity of mitochondrial 1676428 membranes was measured using swelling assay and transmission electron microscopy (TEM) analysis.Table 1. Rat primers used for RT-PCR.Gene GAPDH gp91phox NOX4 AT-1R TNF-a eNOS iNOS CPT1 CPT2 PGC1a PGC1b UCPTNF agacagccgcatcttcttgt cggaatcctctccttcct ttctacatgctgctgctgct caacctccagcaatcctttc gtcgtagcaaaccaccaagc ggcatacagaacccaggatg ccttgttcagctacgccttc ctcagcctctacggcaaatc ctaatcccaaggtgcttcca aagcaggtctctccttgcag tggatgagctttcactgctg ggcccaacatcacaagaaacAntisense cttgccgtgggtagagtcat gcattcacacaccactccac aaaaccctccaggcaaagat cccaaatccatacagccact tgtgggtgaggagcacatag ggatgcaaggcaagttagga ggtatgcccgagttctttca tgcccatgagtgttctgtgt cttcagttgggctctt ccatcccgtagttcactggt tggatgagctttcactgctg agctccaaaggcagagacaaBlood PressureBlood pressure were measured noninvasively using a Coda 6 Blood Pressure System (Kent Scientific, Torrington, CT), which utilizes a tail-cuff 25837696 occlusion method and volume pressure recording (VPR) sensor technology. In this system, unanesthtized rats from each group were warmed to an ambient temperature of 30uC by placing them in a holding device mounted on a thermostatically controlled warming plate. Rats were allowed to habituate to thisdoi:10.1371/journal.pone.0046568.tTNF, ANG II, and Mitochondrial DysfunctionIsolation of Mitochondria and Mitochondrial Functional StudiesLV mitochondria were isolated by differential centrifugation of heart homogenates as described previously [11]; for assessment of permeability transition pore opening, mitochondrial swelling was measured as described previously [11,22]. Ultrastructural examination of isolated mitochondrial preparations was performed as described before [22].Table 2. Blood pressure data from control and experimental groups.DaysMAP mmHg Control TNF 11060.55 11560.11 11060.22 11060.02 11560.22 TNF +LOS 10560.23 11060.05 10560.05 11060.11 11460.111161.57 10860.69 10960.33 11260.88 11460.Western BlottingProtein expression in mitochondria was analyzed by western blotting as previously described [11,22], using anti-ANT, anticytochrome c and anti-VDAC antibodies (Santa Cruz Biotechnology). The band intensities were quantified using a BioRad ChemiDoc imaging system and normalized to VDAC.3 4Mitochondrial O2N2 and H2O2 production in mitochondria were measured using EPR as described previously [12,22]. [23]Aliquots of isolated LV mitochondria were probed with PPH (500 mM) alone or PPH and SOD (50 U/ml) for quantification of O2N2 production. Catalase (50 U/ml) was added to measure H2O2 formation. PPH allows the detection of extracellular and extra mitochondrial production of O2N2 [24]. PPH reacts with O2N2 to produce a stable PPN nitroxide radical which can be detected with EPR [25]. After adequate mixing, 50 ml of mitochondria were taken in 50 ml glass capillary tubes. Mitochondrial O2N2 production and H2O2 production were determined by EPR under the same settings as were used for measurement of mitochondrial O2N2 and H2O2 production.Mitochondrial O2N2 and H2O2 ProductionMean a.