In the fly eye [7], suggesting that TORC1 activity may be a

In the fly eye [7], suggesting that TORC1 activity may be a limiting factor in regulating the timing of differentiation in a variety of developmental contexts. In addition to growth of hamartomous tumors in the skin, kidney, lungs, heart and brain, human patients with TSC exhibit non-tumorous skin lesions, such as hypopigmented macules and shagreen patches, and neurological symptoms including developmental delay, seizure and autism [6]. In Drosophila, the catecholamine biosynthetic pathway is used in the adult cuticle to produce intermediates for melanin and sclerotin Sudan I web synthesis, as well as a source of dopamine in dopaminergic neurons in the brain. Although melanogenesis in vertebrates relies on tyrosinase to convert tyrosine to dopa, the neural dopamine pathway is highly conserved between flies and vertebrates [28]. Our findings suggest that increased levels of rate-limiting enzyme, TH, may result in Methionine enkephalin cost dysregulation of catecholamine biosynthesis. Such a mechanism could contribute to the skin lesions, tumors and neurological manifestations observed in human patients, for example by increasing protein levels of oncogenes, metabolic enzymes, neurotransmitters or neuromodulators that are normally under tight translational control [29,30]. Future in vivo studies focusing on cell type-specific TORC1-dependent protein level changes in mutant tissues will provide further insights into the mechanisms driving tumor growth and neural dysfunction in TSC disease.manually decapitated. Each set of heads was homogenized in equal volume (400 ml) of 2.5 sulfosalicylic acid, followed by centrifugation at 10,000 rpm for 15 minutes. All steps were done at 4uC. The clear supernatant was then analyzed using the Biochrom 30 amino acid analyzer (Biochrom, Cambridge, UK).Western Blots and RT-PCRStage P10 pupae were collected and the dorsal thoraces were isolated by manual dissection. For real-time PCR twelve thoraces were collected for RNA extraction using the RNAeasy kit (Qiagen). Probesets used for RT-PCR: TH (TTGAGGAGGATGTTGAGTTTGAGA and CTCGGTGAGACCGTAATCGTT), Rheb (TGAGGTGGTGAAGATCATATACGAA and GCCAGCTTCTTGCCTTCCT) were run using Taqman/and spt4 control (CTCGTGGTACTCCTGCCATTTCTG and TCCACGATTCTTCATGTCACGTA) using cybergreen. Rheb and TH RNA levels were normalized to Spt4 levels in both control and Rheb overexpressing samples. For Western blots fifteen thoraces were collected, homogenized in RIPA buffer, run on a gel and protein transferred to a nitrocellulose membrane. Antibodies used for Western blot were Rabbit anti-Yellow (1:1000, generous gift from S. Carroll), rabbit antiTyrosine hydroxylase (1:1000, W. Neckameyer), and mouse antiactin (Sigma).Supporting InformationFigure S1 Rheb overexpression increases pigmentation on the thorax and abdomen. Male pannier-Gal4 abdomen, showing the narrow dorsal pigment stripe in segments 15826876 A3 and A4 (A). Rheb overexpression expands the dorsal pigment stripe (B). The RhebAV4 allele crossed to pannier-Gal4 shows a pigment patch on the thorax (C), and TSC2RNAi knockdown expands the dorsal pigment stripe (D). Raptor 11967625 knockdown (raptorRNAi lines TRiP.JF01087 and TRiP.JF01088 (Kockel, Kerr, Melnick, et al, 2010)) suppressed Rheb-induced expansion of the dorsal pigment stripe on the male abdomen (E ). rictorRNAi (TRiP.JF01370) does not suppress Rheb-induced pigmentation on the thorax (H). Overexpression of either S6K1TE or S6K1STDETE enhances the thoracic Rheb-induced pigmentation (I, J). (TIF) Figure S2 Rheb induced Pigmentati.In the fly eye [7], suggesting that TORC1 activity may be a limiting factor in regulating the timing of differentiation in a variety of developmental contexts. In addition to growth of hamartomous tumors in the skin, kidney, lungs, heart and brain, human patients with TSC exhibit non-tumorous skin lesions, such as hypopigmented macules and shagreen patches, and neurological symptoms including developmental delay, seizure and autism [6]. In Drosophila, the catecholamine biosynthetic pathway is used in the adult cuticle to produce intermediates for melanin and sclerotin synthesis, as well as a source of dopamine in dopaminergic neurons in the brain. Although melanogenesis in vertebrates relies on tyrosinase to convert tyrosine to dopa, the neural dopamine pathway is highly conserved between flies and vertebrates [28]. Our findings suggest that increased levels of rate-limiting enzyme, TH, may result in dysregulation of catecholamine biosynthesis. Such a mechanism could contribute to the skin lesions, tumors and neurological manifestations observed in human patients, for example by increasing protein levels of oncogenes, metabolic enzymes, neurotransmitters or neuromodulators that are normally under tight translational control [29,30]. Future in vivo studies focusing on cell type-specific TORC1-dependent protein level changes in mutant tissues will provide further insights into the mechanisms driving tumor growth and neural dysfunction in TSC disease.manually decapitated. Each set of heads was homogenized in equal volume (400 ml) of 2.5 sulfosalicylic acid, followed by centrifugation at 10,000 rpm for 15 minutes. All steps were done at 4uC. The clear supernatant was then analyzed using the Biochrom 30 amino acid analyzer (Biochrom, Cambridge, UK).Western Blots and RT-PCRStage P10 pupae were collected and the dorsal thoraces were isolated by manual dissection. For real-time PCR twelve thoraces were collected for RNA extraction using the RNAeasy kit (Qiagen). Probesets used for RT-PCR: TH (TTGAGGAGGATGTTGAGTTTGAGA and CTCGGTGAGACCGTAATCGTT), Rheb (TGAGGTGGTGAAGATCATATACGAA and GCCAGCTTCTTGCCTTCCT) were run using Taqman/and spt4 control (CTCGTGGTACTCCTGCCATTTCTG and TCCACGATTCTTCATGTCACGTA) using cybergreen. Rheb and TH RNA levels were normalized to Spt4 levels in both control and Rheb overexpressing samples. For Western blots fifteen thoraces were collected, homogenized in RIPA buffer, run on a gel and protein transferred to a nitrocellulose membrane. Antibodies used for Western blot were Rabbit anti-Yellow (1:1000, generous gift from S. Carroll), rabbit antiTyrosine hydroxylase (1:1000, W. Neckameyer), and mouse antiactin (Sigma).Supporting InformationFigure S1 Rheb overexpression increases pigmentation on the thorax and abdomen. Male pannier-Gal4 abdomen, showing the narrow dorsal pigment stripe in segments 15826876 A3 and A4 (A). Rheb overexpression expands the dorsal pigment stripe (B). The RhebAV4 allele crossed to pannier-Gal4 shows a pigment patch on the thorax (C), and TSC2RNAi knockdown expands the dorsal pigment stripe (D). Raptor 11967625 knockdown (raptorRNAi lines TRiP.JF01087 and TRiP.JF01088 (Kockel, Kerr, Melnick, et al, 2010)) suppressed Rheb-induced expansion of the dorsal pigment stripe on the male abdomen (E ). rictorRNAi (TRiP.JF01370) does not suppress Rheb-induced pigmentation on the thorax (H). Overexpression of either S6K1TE or S6K1STDETE enhances the thoracic Rheb-induced pigmentation (I, J). (TIF) Figure S2 Rheb induced Pigmentati.